BBa_K562006 1 Salty_PduT Salty_PduTU BMC Components 2011-09-15T11:00:00Z 2015-05-08T01:12:41Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence. This is a composite part comprising a constituive promoter (identical to that from the basic part BBa_K562000), which is the tatABCD promoter from E. coli K-12, driving production of the PduT and PduU proteins from Salmonella enterica serovar Typhimurium LT2. These are components of the Salmonella bacterial microcompartment (BMC). The PduU gene product carries a C-terminal 6-His affinity/epitope tag. Production of the PduU protein has been verified by Western immunoblotting (anti-penta-His) and production of both PduT and PduU have been confirmed by 35S-Met labelling. The proteins have also been purified from E. coli by immobilised metal affinity chromatography (IMAC) and identified by tryptic peptide mass fingerprinting. The construct is cloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-TU in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 In stock false Therewas one native PstI sites within the pduU gene. This was removed using PCR-based site-directed mutagenesis. Care was taken not to alter the primary sequence of the gene product. The fragment also carries an engineered BamHI site at its extreme 3' end. false Frank Sargent annotation2129431 1 BBa_K562000 range2129431 1 1 103 annotation2129442 1 pduU gene range2129442 1 673 1020 annotation2129439 1 pduT gene range2129439 1 119 673 annotation2129446 1 Hexa-Histidine Tag range2129446 1 1021 1038 annotation2129434 1 synthetic RBS range2129434 1 107 112 BBa_K562006_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatgtctcaggctataggaattttagaactcaccagcatcgccaaaggcatggagcttggtgatgccatgctgaaaagcgccaacgtcgatctactggtcagcaagaccatctgtccggggaagtttttactgatgctgggcggcgatatcggcgctatccagcaggccattgaaaccggtacgtcgcaggccggcgagatgctcgtcgacagcctggtgctggcgaatattcatcccagcgtacttccggccatcagcggcctgaacagcgtcgataagcgccaggcggtaggtatcgtcgaaacctggagcgtggcggcctgcattagcgccgcagaccgggcggtgaaaggctcaaacgtcaccctggtgcgggtgcatatggccttcggtatcggcggtaaatgctacatggtggtggcgggcgacgtttctgacgtcaataacgccgtgacggttgccagcgaaagcgcgggcgagaaagggttgttggtttaccgttcggtgatcccacgcccgcatgaagccatgtggcgacagatggtggaggggtaatggaaagacaaccgacaacggatcgcatgattcaggaatacgtgccggggaaacaggtcactctcgcgcacctgattgctaatccagggaaagatctctttaagaagctgggcctgcaagatgcagtgtccgccattggcatccttaccatcacgccgagcgaagcatcgattatcgcctgcgatatcgccaccaaatccggcgcggtggaaattggttttctcgatcgctttaccggtgccgtggtgctgaccggcgacgtttctgccgtcgagtatgccctcaagcaggtaacgcgcacgctgggcgaaatgatgcagttcaccacttgctcgatcacccggacgcatcaccatcaccatcactaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z