BBa_K562018 1 PduD40-fMT Salty_PduD40-fMT 2011-09-17T11:00:00Z 2015-05-08T01:12:42Z Derived from Salmonella enterica serovar Typhimurium LT2 genomic sequence and part BBa_K190019. This is a composite part comprising a constitutive promoter, which is the tatABCD promoter from E. coli K-12, driving production of the initial 40 residues of the PduD protein from Salmonella enterica serovar Typhimurium LT2 (identical to part BBa_K562002), which is itself fused in-frame to a metallothionein (fMT) from Fucus vesiculosus (from part BBa_K190019). The fMT gene product also carries a C-terminal HA epitope tag. Production of PduD40-fMT has been verified by Western immunoblotting (anti-mCherry). The construct is cloned as an EcoRI / PstI fragment into pSB1C3. The clone is also known as pSB-D40-fMT in the Sargent Laboratory, Dundee, UK. false false _730_ 0 8083 9 It's complicated false None false Frank Sargent annotation2131852 1 BBa_K190019 range2131852 1 245 442 annotation2131855 1 HA epitope tag range2131855 1 443 469 annotation2131850 1 synthetic RBS range2131850 1 107 112 annotation2131853 1 metallothionein range2131853 1 245 442 annotation2131851 1 PduD40 Tag range2131851 1 119 238 annotation2131849 1 BBa_K562002 range2131849 1 1 244 BBa_K562018_sequence 1 tgtcggttggcgcaaaacacgctgattttttcatcgctcaaggcgggccgtgtaacgtataatgcggctttgtttaatcatcatctaccacagaggaggatcacacagaggaacaggtatggaaattaatgaaaaattgctgcgccagataattgaagacgtactccgcgatatgaagggcagcgataaacccgtctcgtttaatgcgcctgcggcatccacagcaccacagaccgcttctagagcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtatccgtacgatgtgccggactatgcgtaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z