BBa_K563000 1 BBa_K563000 pHIS4 (Multifunctional Histidine biosynthesis enzyme promoter) 2011-09-26T11:00:00Z 2015-05-08T01:12:42Z We isolate the sequece by PCR on Saccharomyces cerevisiae strain BY4742. For standard operation of BioBricks and easy-use for other teams, we add restriction enzyme cutting sites at upstream and downstream of the sequence (BamHI and NcoI respectively) by designing specific primers (details in sequence and feature annotations). HIS4 encodes a multifunctional polypeptide that has phosphoribosyl-ATP pyrophosphatase, phosphoribosyl-AMP cyclohydrolase, and histidinol dehydrogenase activities which can catalyze histidine biosynthesis in yeast. Transcription of HIS4 is regulated by general amino acid control, in which the transcription factor Gcn4p plays a key role. Therefore it is predicted that His4 is under control of a promoter which is sensitive to transcription factor Gcn4p. When TORC1 is inhibited by FAP, dephosphorylated Gcn4 would bind with pHIS4 and activate downstream genes. We put the target gene of mutant Tor2 under this promoter, and then its expression could be controlled by the amount of FAP and the activity of TORC1. Mutant Tor2 would be much resistant to FAP and a feedback loop is formed between FAP, TORC1, Gcn4 and mTor. false false _731_ 0 7159 9 It's complicated false In order to determine the appropriate assembly standard which the part can be used with, it's necessary to check the sequence for each of the restriction enzymes. Sequence scanning of pHis4 show that no EcoRI XhoI XbaI SpeI NcoI PstI BamHI exists. As our target gene comes from yeast and contains common restriction sites like EcoRI, NotI and SpeI, the stantard BioBrick prefix and suffix is no longer appropriate. Furthermore, the size of 7800bp makes it pretty expensive and inconvenient for chemical synthesis and codon optimization to avoid certain restriction sites. To match with the operation of downstream gene, the promoter parts also give up standard prefix and suffix. However, based on the modified plasmid backbone pSB1A5,we bring in some other common restriction sites, which also renders functionality and ease-of-use of promoter parts. false Saisi Xue annotation2144649 1 XhoI+rev primer range2144649 1 495 530 annotation2144647 1 NcoI+fwd primer range2144647 1 1 37 annotation2144648 1 HIS4 Promoter range2144648 1 12 519 BBa_K563000_sequence 1 tcatgccatggacaagattcctcatcggaagaggtggcatccttaacgaaaaaacttgaagaggctaatgaaaaaatcaaacagttggaacaggctcaagcacaaacagccgtggaatcgttgccaattttcgacccccctgcaccagtcgataccacggcaggaagacaacagtggtgtgagcattgcgatacgatgggtcataatacgcagaatgcccccatcacaatcctgacaaccagcagttcttctaggcagtcgaactgactctaatagtgactccggtaaattagttaattaattgctaaaccgatgcacagtgactcacgtttttttatcagtcattcgatatagaaggtaagaaaaggatatgactatgaacagtagtatactgtgtatataatagatatggaacgttatattcacctccgatgtgtgttgtacatacataaaaatatcatagcacaactgcgctgtgtaatagtaatacaatagtttacaaaattttttttctgaatactcgagcggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z