BBa_K564006 1 ChiX small RNA involved in RNA regulation of ChiP 2011-09-18T11:00:00Z 2015-05-08T01:12:42Z This DNA was ordered as a minigene. This device is based on gene encoding small RNA (sRNA), which represses ChiP gene synthesis by pairing with a sequence in 5??? untranslated region (UTR) near ribosome binding site (RBS) of chip messenger RNA (mRNA). This leads to degradation of the targeted mRNA by enzymes called RNases. The repression occurs in the absence of the substrates (chitooligosaccharides) stimulating chip gene transcription. false false _732_ 0 8333 9 Not in stock false There are no design considerations. false Anna Lewinska annotation2136201 1 ChiP range2136201 1 45 55 annotation2135179 1 ChiX range2135179 1 1 84 BBa_K564006_sequence 1 acaccgtcgcttaaagtgacggcataataataaaaaaatgaaattcctctttgacgggccaatagcgatattggccattttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z