BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K564000 1 BBa_K564000 ChiX 2011-09-17T11:00:00Z 2015-05-08T01:12:42Z ChiX is 84 bp long ChiX is 84 bp long false true _732_ 0 8342 9 Not in stock false ChiX is 84 bp long false Damian Rafal Plichta annotation2134903 1 chiX range2134903 1 1 84 BBa_K564007 1 BBa_K564007 Regulatory device based on sRNA 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z Escherichia coli w3110 genomic DNA This device is based on gene encoding small RNA (sRNA), which represses ChiP gene synthesis by pairing with a sequence in 5??? untranslated region (UTR) near ribosome binding site (RBS) of chip messenger RNA (mRNA). (Caught at its own game: regulatory small RNA inactivated by an inducible transcript mimicking its target. Figueroa-Bossi et al. 2009, Genes and development 23:2004-2015) This leads to degradation of the targeted mRNA by enzymes called RNases. (Lauren S. Waters and Gisela Storz, Regulatory RNAs in Bacteria, Cell 136, 615-628, 2009) The repression occurs in the absence of the substrates (chitooligosaccharides) stimulating chip gene transcription. (Caught at its own game: regulatory small RNA inactivated by an inducible transcript mimicking its target. Figueroa-Bossi et al. 2009, Genes and development 23:2004-2015) It is fused with Ptet promoter. true false _732_ 0 8342 9 Discontinued false No design considerations false Damian Rafal Plichta component2134925 1 BBa_B0010 component2134927 1 BBa_B0012 component2134924 1 BBa_K564000 component2134918 1 BBa_R0040 annotation2134924 1 BBa_K564000 range2134924 1 63 146 annotation2134918 1 BBa_R0040 range2134918 1 1 54 annotation2134925 1 BBa_B0010 range2134925 1 155 234 annotation2134927 1 BBa_B0012 range2134927 1 243 283 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K564007_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagacaccgtcgcttaaagtgacggcataataataaaaaaatgaaattcctctttgacgggccaatagcgatattggccattttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K564000_sequence 1 acaccgtcgcttaaagtgacggcataataataaaaaaatgaaattcctctttgacgggccaatagcgatattggccattttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z