BBa_K564015 1 ChiPm ChiP promoter and 5' UTR; RBS mutated AAGAGG-->AGGAGA 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z It was obtained by PCR from Escherichia coli W3110 genomic DNA. ChiP encodes enterobacterial chitoporin required for uptake of chitin-derived oligosaccharides. This outer membrane porin is required for Salmonella and E.coli growth on chitooligosaccharides as a sole source of both carbon and nitrogen. It is only synthesized in the presence of these substrates. In nature it is regulated by sRNAa. We introduced the mutations in this sequence in the regulator binding site. false false _732_ 0 8333 9 Not in stock false There are no geding considereations. false Anna Lewinska annotation2135139 1 changed binding site for ChiX range2135139 1 578 589 annotation2135138 1 ChiP mutated range2135138 1 1 599 BBa_K564015_sequence 1 gggcgaaagtaggcgagtaattttaagtttcgctatgccggatggggcgtttacgtcgcatccggcaaggaacagacaaacagtttcaaacgctaaattgcctgatgcgctacgcttatcaggcctacatgatctctgcaatatattgagtttgcgtgcttttgtaggccggataaggcgttcacgccgcatccggcaagaaacagcaaacaatccaaaacgccgcgttcagcggcgttttttctgcttttcttcgcgaattaattccgcttcgcaatttatccataaaataaatttaaaataacaaaacataattaaataaaatgtaaccgctttcatcttgctggaatttcacgcttttattcttctgcaagcctttcaaccgcaaacttaagccttgtaacaaaaatcatcaaaatatgtgcggttgctcatgttcttacattctggttacagaaagagattgataattcgcgtcgcgaaaaatagtctgttcctgtagtcagcgagacttttctcaacgctacttttttaatttttattttttcgctgttcacctttggtgcagcaatttatacgtcaaggagaattaacccatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z