BBa_K564019 1 ChiXm Mutated small RNA involved in RNA regulation of ChiP. 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z We obtained this part from minigene. We introduced mutations in the binding site to both ChiP and ChiXR in order to show that basepairing is essential for this regulatory system. false false _732_ 0 8333 9 Not in stock false There are no design considerations. false Anna Lewinska annotation2136202 1 altered binding for ChiP range2136202 1 45 55 annotation2136189 1 ChiX mutated range2136189 1 1 84 BBa_K564019_sequence 1 acaccgtcgcttaaagtgacggcataataataaaaaaatgaaatttctccttgacgggccaatagcgatattggccattttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z