BBa_K564019 1 ChiXm Mutated small RNA involved in RNA regulation of ChiP. 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z We obtained this part from minigene. We introduced mutations in the binding site to both ChiP and ChiXR in order to show that basepairing is essential for this regulatory system. false false _732_ 0 8333 9 Not in stock false There are no design considerations. false Anna Lewinska annotation2136202 1 altered binding for ChiP range2136202 1 45 55 annotation2136189 1 ChiX mutated range2136189 1 1 84 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K564020 1 Ptet-ChiXm Mutated regulatory device based on sRNA. 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z Both promoter as well as ChiX was obtained from minigenes. This device is based on gene encoding small RNA (sRNA)called ChiX, which represses ChiP gene synthesis by pairing with a sequence in 5??? untranslated region (UTR) near ribosome binding site (RBS) of chiP mRNA. This leads to degradation of the targeted mRNA by enzymes called RNases. The repression occurs in the absence of the substrates (chitooligosaccharides) stimulating chiP gene transcription. It is fused with Ptet promoter. In this biobrick we introduced mutations in the ChiP and ChiX binding site of ChiX in order to show that basepairing is essential for this regulatory system. false false _732_ 0 8333 9 Not in stock false There are no design considerations. false Anna Lewinska component2136192 1 BBa_K564018 component2136197 1 BBa_B0012 component2136195 1 BBa_B0010 component2136194 1 BBa_K564019 annotation2136197 1 BBa_B0012 range2136197 1 813 853 annotation2136192 1 BBa_K564018 range2136192 1 1 624 annotation2136194 1 BBa_K564019 range2136194 1 633 716 annotation2136195 1 BBa_B0010 range2136195 1 725 804 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K564018 1 BBa_K564018 tet promoter 2011-09-19T11:00:00Z 2015-05-08T01:12:42Z This part was obtained in minigenes. something false false _732_ 0 8333 9 Not in stock false There are no design considerations. false Anna Lewinska annotation2136124 1 tet range2136124 1 1 624 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K564019_sequence 1 acaccgtcgcttaaagtgacggcataataataaaaaaatgaaatttctccttgacgggccaatagcgatattggccattttttt BBa_K564018_sequence 1 ttaagacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaatacgcaacctaaagtaaaatgccccacagcgctgagtgcatataatgcattctctagtgaaaaaccttgttggcataaaaaggctaattgattttcgagagtttcatactgtttttctgtaggccgtgtacctaaatgtacttttgctccatcgcgatgacttagtaaagcacatctaaaacttttagcgttattacgtaaaaaatcttgccagctttccccttctaaagggcaaaagtgagtatggtgcctatctaacatctcaatggctaaggcgtcgagcaaagcccgcttattttttacatgccaatacaatgtaggctgctctacacctagcttctgggcgagtttacgggttgttaaaccttcgattccgacctcattaagcagctctaatgcgctgttaatcactttacttttatctaatctgctcat BBa_K564020_sequence 1 ttaagacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaatacgcaacctaaagtaaaatgccccacagcgctgagtgcatataatgcattctctagtgaaaaaccttgttggcataaaaaggctaattgattttcgagagtttcatactgtttttctgtaggccgtgtacctaaatgtacttttgctccatcgcgatgacttagtaaagcacatctaaaacttttagcgttattacgtaaaaaatcttgccagctttccccttctaaagggcaaaagtgagtatggtgcctatctaacatctcaatggctaaggcgtcgagcaaagcccgcttattttttacatgccaatacaatgtaggctgctctacacctagcttctgggcgagtttacgggttgttaaaccttcgattccgacctcattaagcagctctaatgcgctgttaatcactttacttttatctaatctgctcattactagagacaccgtcgcttaaagtgacggcataataataaaaaaatgaaatttctccttgacgggccaatagcgatattggccattttttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z