BBa_K566000 1 OL OL region from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. OL region form Lambda phage. It is used to allow a construction to be controlled dually by cI protein. cI protein may interact with pRM promoter and OL region in order to form an octameric structure which permits, first the activation of transcription from pRM promoter and then effectively repression from it as well. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2146174 1 OL range2146174 1 1 129 BBa_K566000_sequence 1 cagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z