BBa_K566000 1 OL OL region from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. OL region form Lambda phage. It is used to allow a construction to be controlled dually by cI protein. cI protein may interact with pRM promoter and OL region in order to form an octameric structure which permits, first the activation of transcription from pRM promoter and then effectively repression from it as well. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2146174 1 OL range2146174 1 1 129 BBa_K566002 1 BS Biphasic switch 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z Extracted directly from Lambda genome by separate as pRM and OL parts, constructed by classic BioBricks system. Biphasic switch is a composite part which permits positive and negative regulation of a gene set through pRM promoter and OL region from Lambda phage. false false _734_ 0 8650 9 Not in stock true Distance between pRM and OL must be longer than 1.6 kb due to necessity of loop formation for more effiecient repression state of the switch. false Daniel Rodriguez, Porfirio Quintero component2142164 1 BBa_K566000 component2142163 1 BBa_K566001 annotation2142164 1 BBa_K566000 range2142164 1 94 222 annotation2142163 1 BBa_K566001 range2142163 1 1 85 BBa_K566001 1 pRM pRM promoter from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. pRM promoter from Lambda phage. It may be positive and negative regulated according to cI protein concentration. It needs OL region in order to achieve better negative regulation. It may be used to establish a biphasic switch which could permit activation and repression of genes transcribed from it. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2145891 1 pRM range2145891 1 1 85 BBa_K566001_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt BBa_K566002_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgttactagagcagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatact BBa_K566000_sequence 1 cagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z