BBa_K566008 1 Mnt opt Mnt repressor optimized for E. coli 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Original sequence was taken from BioBrick BBa_C0072, this was optimized with preferential codons for better expression into E. coli. Mnt repressor optimized with preferential codons for better expression into E. coli. This protein acts as a negative regulator for pMnt promoter (BBa_R0073) false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and removed. false Daniel Rodriguez annotation2142578 1 LVA range2142578 1 250 282 annotation2142577 1 mnt range2142577 1 1 249 BBa_K566006 1 BBa_K566006 penI-pCpcG2-pPenI-mnt 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence of pCpcG2 promoter was obtained from pJT122 plasmid of Dr. Jeff Tabor. Rest of the sequences were obtained from the Registry. Complete construction was synthesized. Potential and gate. Composed of pCpcG2 promoter which may be inducible by green light, this way it express penI and this represses mnt expression, allowing the transcription of any gene controlled under pMnt promoter. This construction may be used with another one which represses mnt expression with red light and this way it may act as an and-gate. false false _734_ 0 8650 9 Not in stock true Search for illegal sites was performed, they were found and removed. false Daniel Rodriguez and Porfirio Quintero component2142634 1 BBa_B0034 component2142644 1 BBa_B0034 component2142642 1 BBa_R0074 component2142647 1 BBa_K566008 component2142636 1 BBa_K566009 component2142632 1 BBa_K566010 annotation2142647 1 BBa_K566008 range2142647 1 765 1052 annotation2142634 1 BBa_B0034 range2142634 1 424 435 annotation2142644 1 BBa_B0034 range2142644 1 753 764 annotation2142632 1 BBa_K566010 range2142632 1 1 423 annotation2142642 1 BBa_R0074 range2142642 1 676 752 annotation2142636 1 BBa_K566009 range2142636 1 436 675 BBa_R0074 1 PenI Promoter (PenI regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z bacillus licheniformis Released HQ 2013 PenP operator from Bacillus Lichenformis. Two operator sites are negatively regulated by PenI (C0074). false false _1_ 0 24 7 In stock false extends slightly past -50 true crackdots annotation319788 1 dimer left half range319788 1 31 53 annotation319211 1 -35 range319211 1 23 28 annotation319212 1 -10 range319212 1 46 51 annotation319789 1 dimer right half range319789 1 55 76 annotation302713 1 PenI range302713 1 1 77 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K566010 1 PenI inv PenI repressor optimized for E. coli (inverted sequence) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Original sequence was taken from Registry (BBa_C0074), this was optimized with preferential codons for better expression in E. coli. PenI repressor with codon optimization for improving expression into E. coli. This protein represents a negative repressor for pPenI promoter (BBa_R0074). Sequence was inverted for simplifying DNA synthesis. false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and eliminated. false Daniel Rodriguez annotation2142350 1 Start codon range2142350 1 421 423 annotation2142321 1 PenI repressor range2142321 1 1 423 annotation2142349 1 Stop codon range2142349 1 1 6 BBa_K566009 1 pCpcG2 inv pCpcG2 promoter, inverted sequence (Green light inducible) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was obtained from pJT122 plasmid of Dr. Jeff Tabor, but it was synthesized. pCpcG2 promoter (inverted sequence) from pJT122 plasmid of Dr. Jeff Tabor. This promoter is inducible with green light through ccaR and ccaS photoreceptor system. false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, no sites were found. false Daniel Rodriguez annotation2142152 1 pCpcG2 promoter range2142152 1 1 240 BBa_R0074_sequence 1 tcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttg BBa_B0034_sequence 1 aaagaggagaaa BBa_K566006_sequence 1 ttattatgcaaccagtgcataattttcgtcgttggctgcttcttttttgcggtttttatgttcttccaggatctgatacagttcgttaatttcttcaccgctcagctgatcattttccagaaagttcagaaccatactattcagggtgccgttataaaagcggttcagaaagctatggcttttaacttcgatgtaatcgctctcatcaatattcggggtataaacaaaaacgcgaccctctttatgatgattcagtgcaccttttttgatcagacgcagcagcatggtctgaatggttttcggtgaccaggtgctggttttgctcagttctttaatcacttcgttggtattgatgctgctgtgtttccaaatcactttcataacttccagttcggcatcactgatctgcgggatttttttcataaagaggagaaaagagcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatcttcatttccaaccgaaaaaaggcttgcatttaaatcttacatatgtaatactttcaaagactacatttgtaagatttgaaagaggagaaaatggcacgcgacgatccgcattttaactttcgtatgccgatggaagttcgcgagaaactgaaatttcgtgccgaagcaaatggtcgtagcatgaatagcgaactgctgcaaattgttcaggatgccctgagcaaaccgagtccggttaccggttatcgtaatgatgcagaacgtctggcagatgaacagagcgaactggtcaaaaaaatggtttttgataccctgaaagatctgtacaaaaaaaccaccgcagccaatgatgagaactatgccctggtggcctaataa BBa_K566010_sequence 1 ttattatgcaaccagtgcataattttcgtcgttggctgcttcttttttgcggtttttatgttcttccaggatctgatacagttcgttaatttcttcaccgctcagctgatcattttccagaaagttcagaaccatactattcagggtgccgttataaaagcggttcagaaagctatggcttttaacttcgatgtaatcgctctcatcaatattcggggtataaacaaaaacgcgaccctctttatgatgattcagtgcaccttttttgatcagacgcagcagcatggtctgaatggttttcggtgaccaggtgctggttttgctcagttctttaatcacttcgttggtattgatgctgctgtgtttccaaatcactttcataacttccagttcggcatcactgatctgcgggatttttttcat BBa_K566008_sequence 1 atggcacgcgacgatccgcattttaactttcgtatgccgatggaagttcgcgagaaactgaaatttcgtgccgaagcaaatggtcgtagcatgaatagcgaactgctgcaaattgttcaggatgccctgagcaaaccgagtccggttaccggttatcgtaatgatgcagaacgtctggcagatgaacagagcgaactggtcaaaaaaatggtttttgataccctgaaagatctgtacaaaaaaaccaccgcagccaatgatgagaactatgccctggtggcctaataa BBa_K566009_sequence 1 agagcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z