BBa_K566007 1 BBa_K566007 PenI repressor optimized for E. coli 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Original sequence was taken from Registry (BBa_C0074), this was optimized with preferential codons for better expression in E. coli. PenI repressor with codon optimization for improving expression into E. coli. This protein represents a negative repressor for pPenI promoter (BBa_R0074). false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and eliminated. false Daniel Rodriguez annotation2142552 1 penI range2142552 1 1 387 annotation2142555 1 Stop codon range2142555 1 418 423 annotation2142553 1 LVA range2142553 1 385 417 BBa_K566007_sequence 1 atgaaaaaaatcccgcagatcagtgatgccgaactggaagttatgaaagtgatttggaaacacagcagcatcaataccaacgaagtgattaaagaactgagcaaaaccagcacctggtcaccgaaaaccattcagaccatgctgctgcgtctgatcaaaaaaggtgcactgaatcatcataaagagggtcgcgtttttgtttataccccgaatattgatgagagcgattacatcgaagttaaaagccatagctttctgaaccgcttttataacggcaccctgaatagtatggttctgaactttctggaaaatgatcagctgagcggtgaagaaattaacgaactgtatcagatcctggaagaacataaaaaccgcaaaaaagaagcagccaacgacgaaaattatgcactggttgcataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z