BBa_K566008 1 Mnt opt Mnt repressor optimized for E. coli 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Original sequence was taken from BioBrick BBa_C0072, this was optimized with preferential codons for better expression into E. coli. Mnt repressor optimized with preferential codons for better expression into E. coli. This protein acts as a negative regulator for pMnt promoter (BBa_R0073) false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and removed. false Daniel Rodriguez annotation2142577 1 mnt range2142577 1 1 249 annotation2142578 1 LVA range2142578 1 250 282 BBa_K566008_sequence 1 atggcacgcgacgatccgcattttaactttcgtatgccgatggaagttcgcgagaaactgaaatttcgtgccgaagcaaatggtcgtagcatgaatagcgaactgctgcaaattgttcaggatgccctgagcaaaccgagtccggttaccggttatcgtaatgatgcagaacgtctggcagatgaacagagcgaactggtcaaaaaaatggtttttgataccctgaaagatctgtacaaaaaaaccaccgcagccaatgatgagaactatgccctggtggcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z