BBa_K566009 1 pCpcG2 inv pCpcG2 promoter, inverted sequence (Green light inducible) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was obtained from pJT122 plasmid of Dr. Jeff Tabor, but it was synthesized. pCpcG2 promoter (inverted sequence) from pJT122 plasmid of Dr. Jeff Tabor. This promoter is inducible with green light through ccaR and ccaS photoreceptor system. false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, no sites were found. false Daniel Rodriguez annotation2142152 1 pCpcG2 promoter range2142152 1 1 240 BBa_K566009_sequence 1 agagcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgttgcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttcaattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaacttttaagtttaattactaactttatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z