BBa_K566011 1 cI434 opt cI434 repressor from phage 434 optimized for E. coli cI (+LVA) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was taken from BioBrick BBa_C0052 cI434 repressor from phage 434 optimized for E. coli cI (+LVA) false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and deleted. false Daniel Rodriguez annotation2142580 1 LVA range2142580 1 631 669 annotation2142579 1 cI434 range2142579 1 1 669 BBa_K566014 1 BBa_K566014 pRM-RBS-cI434 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Synthesized DNA. Composite part for Biphasic switch tests. true false _734_ 0 8650 9 Discontinued false Search for illegal sites was performed, they were found and deleted. false Daniel Rodriguez component2142585 1 BBa_K566001 component2142587 1 BBa_B0032 component2142591 1 BBa_K566011 annotation2142585 1 BBa_K566001 range2142585 1 1 85 annotation2142591 1 BBa_K566011 range2142591 1 99 767 annotation2142587 1 BBa_B0032 range2142587 1 86 98 BBa_K566001 1 pRM pRM promoter from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. pRM promoter from Lambda phage. It may be positive and negative regulated according to cI protein concentration. It needs OL region in order to achieve better negative regulation. It may be used to establish a biphasic switch which could permit activation and repression of genes transcribed from it. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2145891 1 pRM range2145891 1 1 85 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K566011_sequence 1 atgagcattagcagccgtgttaaaagcaaacgtattcagctgggtctgaatcaggcagaactggcacagaaagttggcaccacccagcagagcattgaacagctggaaaatggtaaaaccaaacgtccgcgttttctgccggaactggcaagcgcactgggtgttagcgttgattggctgctgaatggcaccagcgatagcaatgttcgttttgttggtcatgttgaaccgaaaggtaaatatccgctgattagcatggttcgtgcaggtagctggtgtgaagcatgtgaaccgtatgatatcaaagatatcgatgagtggtatgactccgatgttaatctgctgggcaatggtttttggctgaaagttgaaggtgatagcatgaccagtccggttggtcagagcattccggaaggtcatatggttctggttgataccggtcgtgaaccggttaatggtagcctggttgttgcaaaactgaccgatgcaaatgaagccaccttcaaaaaactggttattgatggtggtcagaaatacctgaaaggcctgaatccgagctggccgatgaccccgattaatggtaattgcaaaattatcggtgttgtggttgaagcccgtgtgaaatttgttgcagcaaacgatgaaaattatgccctggttgcctaataa BBa_K566001_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt BBa_B0032_sequence 1 tcacacaggaaag BBa_K566014_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgttcacacaggaaagatgagcattagcagccgtgttaaaagcaaacgtattcagctgggtctgaatcaggcagaactggcacagaaagttggcaccacccagcagagcattgaacagctggaaaatggtaaaaccaaacgtccgcgttttctgccggaactggcaagcgcactgggtgttagcgttgattggctgctgaatggcaccagcgatagcaatgttcgttttgttggtcatgttgaaccgaaaggtaaatatccgctgattagcatggttcgtgcaggtagctggtgtgaagcatgtgaaccgtatgatatcaaagatatcgatgagtggtatgactccgatgttaatctgctgggcaatggtttttggctgaaagttgaaggtgatagcatgaccagtccggttggtcagagcattccggaaggtcatatggttctggttgataccggtcgtgaaccggttaatggtagcctggttgttgcaaaactgaccgatgcaaatgaagccaccttcaaaaaactggttattgatggtggtcagaaatacctgaaaggcctgaatccgagctggccgatgaccccgattaatggtaattgcaaaattatcggtgttgtggttgaagcccgtgtgaaatttgttgcagcaaacgatgaaaattatgccctggttgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z