BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K566015 1 BBa_K566015 pRM-RBS-cI434 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Synthesized DNA. Composite part for Biphasic switch tests. false false _734_ 0 8650 9 It's complicated true Search for illegal sites was performed, they were found and deleted. false Daniel Rodriguez component2146403 1 BBa_B0034 component2146408 1 BBa_B0034 component2146401 1 BBa_K566001 component2146406 1 BBa_K566011 annotation2146401 1 BBa_K566001 range2146401 1 1 85 annotation2146403 1 BBa_B0034 range2146403 1 94 105 annotation2146406 1 BBa_K566011 range2146406 1 112 780 annotation2146408 1 BBa_B0034 range2146408 1 789 800 BBa_K566001 1 pRM pRM promoter from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. pRM promoter from Lambda phage. It may be positive and negative regulated according to cI protein concentration. It needs OL region in order to achieve better negative regulation. It may be used to establish a biphasic switch which could permit activation and repression of genes transcribed from it. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2145891 1 pRM range2145891 1 1 85 BBa_K566011 1 cI434 opt cI434 repressor from phage 434 optimized for E. coli cI (+LVA) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was taken from BioBrick BBa_C0052 cI434 repressor from phage 434 optimized for E. coli cI (+LVA) false false _734_ 0 8650 9 Not in stock false Search for illegal sites was performed, they were found and deleted. false Daniel Rodriguez annotation2142579 1 cI434 range2142579 1 1 669 annotation2142580 1 LVA range2142580 1 631 669 BBa_B0034_sequence 1 aaagaggagaaa BBa_K566011_sequence 1 atgagcattagcagccgtgttaaaagcaaacgtattcagctgggtctgaatcaggcagaactggcacagaaagttggcaccacccagcagagcattgaacagctggaaaatggtaaaaccaaacgtccgcgttttctgccggaactggcaagcgcactgggtgttagcgttgattggctgctgaatggcaccagcgatagcaatgttcgttttgttggtcatgttgaaccgaaaggtaaatatccgctgattagcatggttcgtgcaggtagctggtgtgaagcatgtgaaccgtatgatatcaaagatatcgatgagtggtatgactccgatgttaatctgctgggcaatggtttttggctgaaagttgaaggtgatagcatgaccagtccggttggtcagagcattccggaaggtcatatggttctggttgataccggtcgtgaaccggttaatggtagcctggttgttgcaaaactgaccgatgcaaatgaagccaccttcaaaaaactggttattgatggtggtcagaaatacctgaaaggcctgaatccgagctggccgatgaccccgattaatggtaattgcaaaattatcggtgttgtggttgaagcccgtgtgaaatttgttgcagcaaacgatgaaaattatgccctggttgcctaataa BBa_K566001_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt BBa_K566015_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgttactagagaaagaggagaaatactagatgagcattagcagccgtgttaaaagcaaacgtattcagctgggtctgaatcaggcagaactggcacagaaagttggcaccacccagcagagcattgaacagctggaaaatggtaaaaccaaacgtccgcgttttctgccggaactggcaagcgcactgggtgttagcgttgattggctgctgaatggcaccagcgatagcaatgttcgttttgttggtcatgttgaaccgaaaggtaaatatccgctgattagcatggttcgtgcaggtagctggtgtgaagcatgtgaaccgtatgatatcaaagatatcgatgagtggtatgactccgatgttaatctgctgggcaatggtttttggctgaaagttgaaggtgatagcatgaccagtccggttggtcagagcattccggaaggtcatatggttctggttgataccggtcgtgaaccggttaatggtagcctggttgttgcaaaactgaccgatgcaaatgaagccaccttcaaaaaactggttattgatggtggtcagaaatacctgaaaggcctgaatccgagctggccgatgaccccgattaatggtaattgcaaaattatcggtgttgtggttgaagcccgtgtgaaatttgttgcagcaaacgatgaaaattatgccctggttgcctaataatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z