BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K566012 1 cI opt cI repressor from Lambda phage optimized for E. coli cI (+LVA) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was obtained form BioBrick BBa_C0052, it was optimized changing for preferential codons as possible and then synthesized. cI repressor from Lambda phage optimized for E. coli cI (+LVA). Preferential codons for better expression into E. coli. Includes LVA tag. false false _734_ 0 8650 9 Not in stock false Search for illegal sites for classic BioBricks was performed, they were detected and eliminated. false Daniel Rodriguez annotation2142581 1 cI range2142581 1 1 711 annotation2142582 1 LVA range2142582 1 712 744 BBa_K566016 1 BBa_K566016 OL-pTetMnt-cI 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Synthesized DNA. Induction system for Biphasic Switch. It responds to negative repression from TetR or cI repressor. false false _734_ 0 8650 9 Not in stock false Coding sequences were optimized with preferential codons. Search for illegal sites was performed, sites were localized and deleted. false Daniel Rodriguez component2142685 1 BBa_K566000 component2142690 1 BBa_K091105 component2142692 1 BBa_B0032 component2142696 1 BBa_K566012 annotation2142685 1 BBa_K566000 range2142685 1 1 129 annotation2142692 1 BBa_B0032 range2142692 1 228 240 annotation2142690 1 BBa_K091105 range2142690 1 130 227 annotation2142696 1 BBa_K566012 range2142696 1 241 990 BBa_K566000 1 OL OL region from Lambda 2011-09-25T11:00:00Z 2015-05-08T01:12:42Z It comes directly from genomic DNA of Lambda phage. It was extracted by PCR as recommended by the Registry. OL region form Lambda phage. It is used to allow a construction to be controlled dually by cI protein. cI protein may interact with pRM promoter and OL region in order to form an octameric structure which permits, first the activation of transcription from pRM promoter and then effectively repression from it as well. false false _734_ 0 8650 9 Not in stock false Analysis of illegal restriction sites was performed, but it does not have them originally. false Daniel Rodriguez, Eduardo Almeyda, Porfirio Quintero annotation2146174 1 OL range2146174 1 1 129 BBa_K091105 1 BBa_K091105 pTet/Mnt Hybrid Promoter 2008-06-18T11:00:00Z 2015-05-08T01:08:37Z This part comes from the Mnt promoter and the TetR promoter This promoter is a modified version of the Mnt promoter that is also responsive to TetR. The promoter should be repressed by Mnt repressor. It should also be repressed by TetR, and in the absence of Mnt repressor, should be induced by aTc. false false _191_ 0 3080 9 It's complicated true Mnt repressor binds as a tetramer to two half-operator sites. Introduction of TetR binding sites between the Mnt promoter -10 sequence and the start site for transcription should allow for repression by TetR. Accordingly, the hybrid promoter was designed by 1) Remove all bases of mnt promoter 3??? to -10: gagtcgtattaattt will be replaced by tccctatcagtgata, and 2) truncate the second half of ptet -10 and mutate -35 so that it function to bind tetR (replace ttgaca with actgta), but is not a promoter, and 3) place the tetR1 and tetR2 binding sites 3??? to truncated mnt -10 sequence. true Robert Cool annotation1963740 1 tetR1 range1963740 1 53 71 annotation1963739 1 -10 range1963739 1 47 52 annotation1963742 1 Mnt range1963742 1 1 52 annotation1963741 1 tetR2 range1963741 1 78 98 BBa_K566016_sequence 1 cagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttccctatcagtgatagagaactgtaatccctatcagtgatagagattcacacaggaaagatgagcaccaaaaaaaaaccgctgacccaagaacagctggaagatgcacgtcgtctgaaagcaatctacgagaaaaaaaaaaatgaactgggcctgagccaagaaagcgttgcagataaaatgggtatgggtcagagcggtgttggtgcactgtttaatggtattaatgcactgaatgcctataatgcagcactgctggcaaaaattctgaaagttagcgttgaagagttcagcccgagcattgcacgtgaaatctatgaaatgtatgaagccgttagcatgcagccgagcctgcgtagcgaatatgaatatccggtttttagccatgttcaggcaggtatgtttagtccggaactgcgtacctttaccaaaggtgatgcagaacgttgggttagcacaaccaaaaaagcaagcgatagcgcattttggctggaagttgaaggtaatagcatgaccgcaccgaccggtagcaaaccgagctttccggatggtatgctgattctggttgatccggaacaggcagttgaaccgggtgatttttgtattgcacgtctgggtggtgatgagttcaccttcaaaaaactgattcgtgatagcggtcaggtttttctgcaaccgctgaatccgcagtatccgatgattccgtgtaatgaaagctgtagcgttgtgggtaaagttattgcaagccagtggcctgaagaaacctttggtgcagcaaatgatgaaaattatgcactggtggcctgataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K566012_sequence 1 atgagcaccaaaaaaaaaccgctgacccaagaacagctggaagatgcacgtcgtctgaaagcaatctacgagaaaaaaaaaaatgaactgggcctgagccaagaaagcgttgcagataaaatgggtatgggtcagagcggtgttggtgcactgtttaatggtattaatgcactgaatgcctataatgcagcactgctggcaaaaattctgaaagttagcgttgaagagttcagcccgagcattgcacgtgaaatctatgaaatgtatgaagccgttagcatgcagccgagcctgcgtagcgaatatgaatatccggtttttagccatgttcaggcaggtatgtttagtccggaactgcgtacctttaccaaaggtgatgcagaacgttgggttagcacaaccaaaaaagcaagcgatagcgcattttggctggaagttgaaggtaatagcatgaccgcaccgaccggtagcaaaccgagctttccggatggtatgctgattctggttgatccggaacaggcagttgaaccgggtgatttttgtattgcacgtctgggtggtgatgagttcaccttcaaaaaactgattcgtgatagcggtcaggtttttctgcaaccgctgaatccgcagtatccgatgattccgtgtaatgaaagctgtagcgttgtgggtaaagttattgcaagccagtggcctgaagaaacctttggtgcagcaaatgatgaaaattatgcactggtggcctgataa BBa_K566000_sequence 1 cagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatact BBa_K091105_sequence 1 ctcgaggtgagtgcacagtactaggtccacggtgacctagatctcctatagttccctatcagtgatagagaactgtaatccctatcagtgatagagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z