BBa_K566017 1 BBa_K566017 pRM434-RFP 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Synthesized DNA. Red Fluorescent Protein under the control of pRM434 promoter. It was constructed for demonstrating dual state of a biphasic switch. false false _734_ 0 8650 9 It's complicated true Search for illegal sites was performed, sites were localized and deleted. false Daniel Rodriguez component2142708 1 BBa_K566013 component2142702 1 BBa_I12006 component2142704 1 BBa_B0030 annotation2142702 1 BBa_I12006 range2142702 1 1 82 annotation2142708 1 BBa_K566013 range2142708 1 112 834 annotation2142704 1 BBa_B0030 range2142704 1 91 105 BBa_I12006 1 Prm + Modified lamdba Prm promoter (repressed by 434 cI) 2004-07-13T11:00:00Z 2015-08-31T04:07:31Z Bushman(1993), Shih & Gussin (1983) Released HQ 2013 Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) false false _3_ 0 147 7 In stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. true mcnamara annotation837228 1 -10 range837228 1 71 76 annotation786500 1 OR1 lambda range786500 1 9 25 annotation786518 1 OR2 lambda range786518 1 33 49 annotation786365 1 OR1 434 range786365 1 56 69 annotation837284 1 -35 range837284 1 48 53 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K566013 1 RFP opt RFP optimized for E. coli (+LVA) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was taken from BioBrick BBa_J06505, then optimized and synthesized. RFP optimized with preferential codons for better expression into E. coli. Includes LVA tag. false false _734_ 0 8650 9 Not in stock false Sequence was design considering use of preferential codons, as well, a complete search looking for illegal sites for classic BioBricks was performed, they were found and deleted. false Daniel Rodriguez annotation2142583 1 mCherry (RFP) range2142583 1 1 708 annotation2142584 1 LVA range2142584 1 709 717 BBa_K566017_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgttactagagattaaagaggagaaatactagatggttagcaaaggtgaagaggataacatggccatcatcaaagagttcatgcgctttaaagttcacatggaaggtagcgttaatggccacgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagtttatgtatggtagcaaagcctatgttaaacatccggcagatatcccggattatctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcctgcaagatggtgaatttatctataaagttaaactgcgtggcaccaattttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcagcgaacgtatgtatccggaagatggcgcactgaaaggtgaaattaaacagcgcctgaaactgaaagatggcggtcattatgatgcagaagttaaaaccacctataaagccaaaaaaccggttcagctgcctggtgcatataacgttaacattaaactggatatcaccagccacaacgaggattataccattgttgaacagtatgaacgtgcagaaggtcgccatagtaccggtggtatggatgaactgtataaactggttgcctgataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K566013_sequence 1 atggttagcaaaggtgaagaggataacatggccatcatcaaagagttcatgcgctttaaagttcacatggaaggtagcgttaatggccacgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagtttatgtatggtagcaaagcctatgttaaacatccggcagatatcccggattatctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcctgcaagatggtgaatttatctataaagttaaactgcgtggcaccaattttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcagcgaacgtatgtatccggaagatggcgcactgaaaggtgaaattaaacagcgcctgaaactgaaagatggcggtcattatgatgcagaagttaaaaccacctataaagccaaaaaaccggttcagctgcctggtgcatataacgttaacattaaactggatatcaccagccacaacgaggattataccattgttgaacagtatgaacgtgcagaaggtcgccatagtaccggtggtatggatgaactgtataaactggttgcctgataa BBa_I12006_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z