BBa_K566023 1 BBa_K566023 pcyA gene (constitutive expression) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z CDS was extracted by PCR, promoter and terminator were Classic BioBricks. pcyA gene transcribed from constitutive promoter. false false _734_ 0 8650 9 Not in stock false For the project that this part was made, it was needed to use other Assambly Standard. false Daniel Rodriguez component2142750 1 BBa_K566021 component2142757 1 BBa_B0015 component2142748 1 BBa_K081005 annotation2142750 1 BBa_K566021 range2142750 1 65 811 annotation2142757 1 BBa_B0015 range2142757 1 820 948 annotation2142748 1 BBa_K081005 range2142748 1 1 58 BBa_K081005 1 BBa_K081005 constitutive promoter family member and RBS 2008-10-17T11:00:00Z 2015-05-08T01:08:34Z Promoter: John Anderson. RBS: Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. Released HQ 2013 Constitutive promoter (strong) with RBS (strong, efficiency=0.3) false true _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981865 1 BBa_B0030 component1981863 1 BBa_J23100 annotation1981865 1 BBa_B0030 range1981865 1 44 58 annotation1981863 1 BBa_J23100 range1981863 1 1 35 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K566021 1 pcyA CDS pcyA CDS 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z pPLPCB(S) plasmid from Dr. Jeff Tabor pcyA CDS false false _734_ 0 8650 9 Not in stock false No considerations. false Daniel Rodriguez annotation2142741 1 pcyA range2142741 1 1 747 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K081005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K566023_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K566021_sequence 1 atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z