BBa_K081005 1 BBa_K081005 constitutive promoter family member and RBS 2008-10-17T11:00:00Z 2015-05-08T01:08:34Z Promoter: John Anderson. RBS: Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. Released HQ 2013 Constitutive promoter (strong) with RBS (strong, efficiency=0.3) false true _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981865 1 BBa_B0030 component1981863 1 BBa_J23100 annotation1981865 1 BBa_B0030 range1981865 1 44 58 annotation1981863 1 BBa_J23100 range1981863 1 1 35 BBa_K566028 1 BBa_K566028 CcaR 2011-09-26T11:00:00Z 2015-05-08T01:12:43Z pJT122 CcaR coding sequence false false _734_ 0 8650 9 Not in stock false No internal sites false Daniel Rodriguez annotation2145570 1 CDS range2145570 1 1 705 annotation2145571 1 Start range2145571 1 1 3 annotation2145569 1 Stop range2145569 1 703 705 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K566029 1 BBa_K566029 CcaR gene (constitutive expression) 2011-09-26T11:00:00Z 2015-05-08T01:12:43Z UANLBrick assambly CcaR gene (constitutive expression) false false _734_ 0 8650 9 Not in stock false UANLBrick assambly false Daniel Rodriguez component2145584 1 BBa_K566028 component2145580 1 BBa_K081005 component2145591 1 BBa_B0015 annotation2145591 1 BBa_B0015 range2145591 1 778 906 annotation2145580 1 BBa_K081005 range2145580 1 1 58 annotation2145584 1 BBa_K566028 range2145584 1 65 769 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K081005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa BBa_K566029_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgagaattcttttagtggaggatgatttgccgctggcggaaacccttgctgaagcattgagtgaccagctttacaccgttgatattgccaccgacgcttccctcgcctgggactatgcctcccgactggaatatgacctcgttattttggatgtgatgctgccggagttggacgggattaccctctgtcaaaaatggcgatcgcacagttatttaatgccaattttgatgatgacagccagggatacgatcaatgataaaatcacgggcttggatgcgggggcggatgattatgtggtcaagccagtggatttgggggagttatttgccagggtgcgagctttgttgcgtcggggttgtgcaacgtgccaaccagttttagagtgggggccaatcaggttggatccaagcacctatgaagttagttatgacaatgaggttttgtctttgacccgcaaggaatacagcattctggaattactactccgcaatggccgtcgggtgctaagtcggagcatgattatcgatagtatctggaagttggagagtcccccagaggaagatacggttaaggtgcatgtgcggagtttgcgacaaaaattaaaaagtgccggtttatcagcagatgccattgaaacggtccatggcattgggtatcgtctggccaatttaacggaaaaatctttgtgccaagggaaaaactagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0030_sequence 1 attaaagaggagaaa BBa_K566028_sequence 1 atgagaattcttttagtggaggatgatttgccgctggcggaaacccttgctgaagcattgagtgaccagctttacaccgttgatattgccaccgacgcttccctcgcctgggactatgcctcccgactggaatatgacctcgttattttggatgtgatgctgccggagttggacgggattaccctctgtcaaaaatggcgatcgcacagttatttaatgccaattttgatgatgacagccagggatacgatcaatgataaaatcacgggcttggatgcgggggcggatgattatgtggtcaagccagtggatttgggggagttatttgccagggtgcgagctttgttgcgtcggggttgtgcaacgtgccaaccagttttagagtgggggccaatcaggttggatccaagcacctatgaagttagttatgacaatgaggttttgtctttgacccgcaaggaatacagcattctggaattactactccgcaatggccgtcgggtgctaagtcggagcatgattatcgatagtatctggaagttggagagtcccccagaggaagatacggttaaggtgcatgtgcggagtttgcgacaaaaattaaaaagtgccggtttatcagcagatgccattgaaacggtccatggcattgggtatcgtctggccaatttaacggaaaaatctttgtgccaagggaaaaactag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z