BBa_K566035 1 OL Inv OL region from Lambda (Inverted) 2011-09-27T11:00:00Z 2015-05-08T01:12:43Z Synthetic DNA Inverted of the OL region from Lambda phage (K566000) false false _734_ 0 8657 9 Not in stock false Search for illegal sites was performed and it was optimized for E.coli codon usage false Jos?? Eduardo Almeyda Carbajal annotation2146514 1 OL (inverted) range2146514 1 1 129 BBa_K566035_sequence 1 agtatcaccgccagtggtatttatgtcaacaccgccagagataatttatcaccgcagatggttatctgtatgttttttatatgaatttattttttgcaggggggcattgtttggtaggtgagagatctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z