BBa_K566036 1 pTet/Mnt I pTet/Mnt Hybrid Promoter (Inverted) 2011-09-27T11:00:00Z 2015-05-08T01:12:43Z Synthetic DNA Inverted version of the Mnt promoter false false _734_ 0 8657 9 Not in stock false A search for illegal sites was performed and it was optimized for E. coli codon usage false Jos?? Eduardo Almeyda Carbajal annotation2146515 1 pTet/Mnt Hybrid Promoter (Inverted) range2146515 1 1 98 BBa_K566036_sequence 1 atctctatcactgatagggattacagttctctatcactgatagggaactataggagatctaggtcaccgtggacctagtactgtgcactcacctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z