BBa_K566013 1 RFP opt RFP optimized for E. coli (+LVA) 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Sequence was taken from BioBrick BBa_J06505, then optimized and synthesized. RFP optimized with preferential codons for better expression into E. coli. Includes LVA tag. false false _734_ 0 8650 9 Not in stock false Sequence was design considering use of preferential codons, as well, a complete search looking for illegal sites for classic BioBricks was performed, they were found and deleted. false Daniel Rodriguez annotation2142584 1 LVA range2142584 1 709 717 annotation2142583 1 mCherry (RFP) range2142583 1 1 708 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K566040 1 BBa_K566040 pRM434-RFP with double terminator 2011-09-27T11:00:00Z 2015-05-08T01:12:43Z Synthetic DNA Red Fluorescent Protein under the control of pRM434 promoter with a double terminator false false _734_ 0 8657 9 Not in stock false Search for illegal sites was performed and it was optimized for E.coli codon usage false Jos?? Eduardo Almeyda Carbajal component2146551 1 BBa_B0015 component2146544 1 BBa_K566017 annotation2146544 1 BBa_K566017 range2146544 1 1 834 annotation2146551 1 BBa_B0015 range2146551 1 843 971 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K566017 1 BBa_K566017 pRM434-RFP 2011-09-25T11:00:00Z 2015-05-08T01:12:43Z Synthesized DNA. Red Fluorescent Protein under the control of pRM434 promoter. It was constructed for demonstrating dual state of a biphasic switch. false false _734_ 0 8650 9 It's complicated true Search for illegal sites was performed, sites were localized and deleted. false Daniel Rodriguez component2142702 1 BBa_I12006 component2142708 1 BBa_K566013 component2142704 1 BBa_B0030 annotation2142704 1 BBa_B0030 range2142704 1 91 105 annotation2142708 1 BBa_K566013 range2142708 1 112 834 annotation2142702 1 BBa_I12006 range2142702 1 1 82 BBa_I12006 1 Prm + Modified lamdba Prm promoter (repressed by 434 cI) 2004-07-13T11:00:00Z 2015-08-31T04:07:31Z Bushman(1993), Shih & Gussin (1983) Released HQ 2013 Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) false false _3_ 0 147 7 In stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. true mcnamara annotation786500 1 OR1 lambda range786500 1 9 25 annotation786365 1 OR1 434 range786365 1 56 69 annotation786518 1 OR2 lambda range786518 1 33 49 annotation837228 1 -10 range837228 1 71 76 annotation837284 1 -35 range837284 1 48 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K566017_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgttactagagattaaagaggagaaatactagatggttagcaaaggtgaagaggataacatggccatcatcaaagagttcatgcgctttaaagttcacatggaaggtagcgttaatggccacgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagtttatgtatggtagcaaagcctatgttaaacatccggcagatatcccggattatctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcctgcaagatggtgaatttatctataaagttaaactgcgtggcaccaattttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcagcgaacgtatgtatccggaagatggcgcactgaaaggtgaaattaaacagcgcctgaaactgaaagatggcggtcattatgatgcagaagttaaaaccacctataaagccaaaaaaccggttcagctgcctggtgcatataacgttaacattaaactggatatcaccagccacaacgaggattataccattgttgaacagtatgaacgtgcagaaggtcgccatagtaccggtggtatggatgaactgtataaactggttgcctgataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K566013_sequence 1 atggttagcaaaggtgaagaggataacatggccatcatcaaagagttcatgcgctttaaagttcacatggaaggtagcgttaatggccacgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagtttatgtatggtagcaaagcctatgttaaacatccggcagatatcccggattatctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcctgcaagatggtgaatttatctataaagttaaactgcgtggcaccaattttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcagcgaacgtatgtatccggaagatggcgcactgaaaggtgaaattaaacagcgcctgaaactgaaagatggcggtcattatgatgcagaagttaaaaccacctataaagccaaaaaaccggttcagctgcctggtgcatataacgttaacattaaactggatatcaccagccacaacgaggattataccattgttgaacagtatgaacgtgcagaaggtcgccatagtaccggtggtatggatgaactgtataaactggttgcctgataa BBa_I12006_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgt BBa_K566040_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagatttaacgttactagagattaaagaggagaaatactagatggttagcaaaggtgaagaggataacatggccatcatcaaagagttcatgcgctttaaagttcacatggaaggtagcgttaatggccacgaatttgaaattgaaggtgaaggcgaaggtcgtccgtatgaaggcacccagaccgcaaaactgaaagttaccaaaggtggtccgctgccgtttgcatgggatattctgagtccgcagtttatgtatggtagcaaagcctatgttaaacatccggcagatatcccggattatctgaaactgagctttccggaaggttttaaatgggaacgtgtgatgaattttgaagatggtggtgttgttaccgttacccaggatagcagcctgcaagatggtgaatttatctataaagttaaactgcgtggcaccaattttccgagtgatggtccggttatgcagaaaaaaaccatgggttgggaagcaagcagcgaacgtatgtatccggaagatggcgcactgaaaggtgaaattaaacagcgcctgaaactgaaagatggcggtcattatgatgcagaagttaaaaccacctataaagccaaaaaaccggttcagctgcctggtgcatataacgttaacattaaactggatatcaccagccacaacgaggattataccattgttgaacagtatgaacgtgcagaaggtcgccatagtaccggtggtatggatgaactgtataaactggttgcctgataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z