BBa_K566760 1 pRM pRM from Lambda Phage 2011-09-09T11:00:00Z 2015-05-08T01:12:43Z This part was extracted directly from Lambda Phage genomic DNA using PCR. This part corresponds to the original pRM promoter from Lambda Phage. It contains the OR1, OR2 and OR3 site, therefore, it can be activated and repressed with cI protein from the same phage. This dual regulation is due to cI activates transcription from this promoter when it is on low concentrations, but when cI concentration is higher it represses transcription. true false _734_ 0 8650 9 Discontinued false It did not need any design considerations but including the corresponding BioBrick prefix and sufix into the primers for the PCR. false Daniel Rodriguez BBa_K566760_sequence 1 gcatgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z