BBa_K567012 1 BBa_K567012 tRNA(Asp)-AGG 2011-09-28T11:00:00Z 2015-05-08T01:12:43Z tRNA(Asp) from AspV in E.coli tRNA(Asp) with its anticodon mutated to CCU(base pairing rare codon AGG) and under the control of lpp promoter. This biobrick is constructed first by cloning the tRNA(Asp) from AspV in E.coli, then the anticodon region is site-directed mutated. false false _735_ 0 8782 9 In stock true the correct processing to produce mature tRNA should be ensured. false Bin Zhao annotation2152866 1 TE range2152866 1 245 267 annotation2152839 1 GTC->CCT range2152839 1 172 174 annotation2152838 1 tRNA-Asp range2152838 1 138 214 annotation2152869 1 polya range2152869 1 268 274 annotation2152858 1 PaspV range2152858 1 80 119 annotation2152837 1 -10 range2152837 1 104 111 annotation2152840 1 -35 range2152840 1 80 88 BBa_K567012_sequence 1 ccaccatacccacgccgaaacctaaaaatagcgacttgggcgatttttgcagcaaacgattcaaaagatgagaaaaaccgttgacgaaggtcgaggcaatccgtaatattcgcctcgttcccaacggaacacaacgcggagcggtagttcagtcggttagaatacctgcctcctacgcagggggtcgcgggttcgagtcccgtccgttccgccactattcactcatgaaaatgagttcagagagccgcaagatttttaattttgcggtttttttgtatttgaattccaccatttctctgttcaagggtggtgcgtaacggcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z