BBa_K567013 1 BBa_K567013 tRNA(Asp)-TAG 2011-09-28T11:00:00Z 2015-05-08T01:12:43Z the tRNA(Asp) from AspV in E.coli Released HQ 2013 tRNA(Asp) with its anticodon mutated to CUA (base pairing stop codon UAG) and under the control of lpp promoter. This biobrick is constructed first by cloning the tRNA(Asp) from AspV in E.coli, then the anticodon region is site-directed mutated. false false _735_ 0 8782 9 In stock true the correct processing of tRNA should be ensured false Bin Zhao annotation2152877 1 GTC->CTA range2152877 1 172 174 annotation2152871 1 -35 range2152871 1 80 88 annotation2152874 1 -10 range2152874 1 104 111 annotation2152876 1 tRNA-Asp range2152876 1 138 214 annotation2152878 1 TE range2152878 1 245 267 annotation2152879 1 polya range2152879 1 268 274 annotation2152873 1 PaspV range2152873 1 80 119 BBa_K567013_sequence 1 ccaccatacccacgccgaaacctaaaaatagcgacttgggcgatttttgcagcaaacgattcaaaagatgagaaaaaccgttgacgaaggtcgaggcaatccgtaatattcgcctcgttcccaacggaacacaacgcggagcggtagttcagtcggttagaatacctgcctctaacgcagggggtcgcgggttcgagtcccgtccgttccgccactattcactcatgaaaatgagttcagagagccgcaagatttttaattttgcggtttttttgtatttgaattccaccatttctctgttcaagggtggtgcgtaacggcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z