BBa_K567016 1 BBa_K567016 metY-CGA 2011-09-28T11:00:00Z 2015-05-08T01:12:43Z tRNA（met）from metY in E.coli K12 Released HQ 2013 This biobrick is constructed by mutating the anticodon of tRNA（met） to TCG (base pairing codon CGA). This tRNA can transfer fMet to CGA when it is used as the start codon. Kana gene with start codon substituted for CGA is used to testify the function of metY-CGA. When this biobrick and metGM(BBa_K567014) or metG(BBa_K567015) are co-transformed into the cell, the cells can survive on the LBKana plate. false false _735_ 0 8782 9 In stock true tRNA(met) has been involved in many operons, we chose metY false You Wang annotation2153280 1 polya range2153280 1 491 496 annotation2153244 1 TE range2153244 1 519 531 annotation2153170 1 tRNA-Met range2153170 1 273 349 annotation2153214 1 TE range2153214 1 475 490 annotation2153173 1 CAT->TCG range2153173 1 307 309 annotation2153186 1 -10 range2153186 1 175 181 annotation2153187 1 -35 range2153187 1 151 156 annotation2153293 1 polya range2153293 1 532 538 annotation2153197 1 PmetY range2153197 1 151 186 BBa_K567016_sequence 1 ccaccatacccacgccgaaacttatcggagacaggaagagtttagtgtgttttttgtaaaataatgcgcttaagggagagcaggagaaggcaaaagtattcaacaaatgaaagtgaactggatattcattcacatgattagcaataaacgttgacaaaatgtggcgtggatcactataatgcctgcagattttacgtcccgtctcggtacaccaaatcccagcagtatttgcattttttacccaaaacgagtagaatttgccacgtttcaggcgcggggtggagcagcctggtagctcgtcgggcttcgaacccgaagatcgtcggttcaaatccggcccccgcaaccactttcccttagagtcctttttcaaatatactgtgaagacttcggccttcgtagtgggatttgaaaaaatccttctggaaagtgctccagaccgcagttgcggttatagggttcagttatataaagccccgatttatcggggttttttgttatctgactacagaataactgggctttaggccctttttttatgtcttgggggtgggcgggtggtgcgtaacggcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z