BBa_K575021 1 BBa_K575021 Genomic LasR/PAI1 Inducible Promoter (Short) 2011-09-21T11:00:00Z 2015-05-08T01:12:45Z It is the upstream regulatory region of [gene]. Released HQ 2013 This is a promoter region extracted from the Pseudomonas Aeruginosa genome. It is activated by the PAI-1/LasR complex, part of the Pseudomonas quorum sensing hierarchy. false false _746_ 0 8753 9 In stock false The part is unusually long for a promoter because of the primers we used to extract it (it is called short because it is shorter than companion part BBa_K575020. We do not know exactly where the regulatory region is. false Michael Vincent Sherer BBa_K575021_sequence 1 ggaggggacggcgccccggatctttgcggaaaccgtagaacggctctccgatgggcctcacggcggtctttctcattgttcttctcgcacgctccatcgtcgtcgggagagcctcccgacaacaaaccttggcccatggcgggcctcgtcgacgaggctccccggggaccagaaatggcaactacatacttccccccctatctctccgcagatacctgcccggaagggcaggttgtccctgccgggctgtgacaatttaattcgaccaggcatttcattgtccgtgccgattttcacgaagcgcattctgaggcaattaaaaagagcgctccattcgaccatggacaagctatccacgcctgaccgagatcgccttccgaatatagcgaagcgataaccgcagcctgccgagaagtgcttcagacaataaacaggacgctggcctttcgtatcgatgaaagttccgcatggcgtccgcccctaaggaagaggagataaatatgatttattacttgatcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z