BBa_K576003 1 BBa_K576003 Left Part of Self-Excising Ribozyme 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z [http://www.rna.whu.edu.cn/perl/gissd/get_seq_exon.cgi?intron_id=304 Group I intron Twort.v.ORF142,2] Released HQ 2013 Modified 3' "half" of intron found in ORF #142 in Twort phage of Staphylococcus aureus in RFC53 MetaPart format. When complemented with 5' "half" (<partinfo>BBa_K576004</partinfo>) in complience with BBFRFC53 assembly standard, the RNA-level excision should leave GGU linker between the whatever comes before K576003 and after K576004. K576003 and K576004 and everything in between them would be removed and possibly circularized. false false _747_ 0 7330 9 In stock false The P1 helix of the intron has been modified to accommodate the MetaPrefix. The part is in RFC53 L-MetaPart format, having GGT and ATG overgangs. false George Zarubin annotation2121633 1 IN1 range2121633 1 11 119 annotation2121632 1 MetaPrefix range2121632 1 1 10 annotation2121634 1 MetaSuffix range2121634 1 120 129 BBa_K576003_sequence 1 gagctcttcaggtaaataattgcctctttatacagtaatgtatatcgaaaaatcctctaattcagggaacacctaaacaaactaagatgtaggcaatcctgagctaagctcttagtatgtgaagagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z