BBa_K576004 1 BBa_K576004 Right Part of Self-Excising Ribozyme 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z [http://www.rna.whu.edu.cn/perl/gissd/get_seq_exon.cgi?intron_id=304 Group I intron Twort.v.ORF142,2] Released HQ 2013 Modified 3' "half" of intron found in ORF #142 in Twort phage of Staphylococcus aureus in RFC53 MetaPart format. When complemented with 5' "half" <partinfo>BBA_K576003</partinfo> in complience with BBFRFC53 assembly standard, the RNA-level excision should leave GGU linker between the whatever comes before K576003 and after K576004. K576003 and K576004 and everything in between them would be removed and possibly circularized. false false _747_ 0 7330 9 In stock false The 3' end has been modified to accommodate MetaSuffix. false George Zarubin annotation2121637 1 MetaSuffix range2121637 1 163 172 annotation2121635 1 MetaPrefix range2121635 1 1 10 annotation2121636 1 IN2 range2121636 1 11 162 BBa_K576004_sequence 1 gagctcttcaggtaataagagaaagtgcaacgactattccgataggaagtagggtcaagtgactcgaaatggggattacccttctagggtagtgatatagtctgatcatatatggaaacatatagaaggataggagtaacgaacctattcgtaacataaatgtgaagagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z