BBa_K576001 1 BBa_K576001 GFP1 HeadPart 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z BBa_I715019 Copy of <partinfo>BBa_I715019</partinfo> in the RFC53 Head Format. false false _747_ 0 7330 9 Not in stock false The part is in recommended RFC53 D-Head format, i.e. the overhang is 5' GGT. false George Zarubin annotation2121628 1 GFP1 range2121628 1 1 474 annotation2121629 1 MetaSuffix range2121629 1 475 484 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K576005 1 BBa_K576005 J23101-RBS-GFP1 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z GFP1 by Davidson-Missouri 2007 Released HQ 2013 The RFC53 HeadPart with promoter and RBS attached. false false _747_ 0 7330 9 In stock false The format is RFC53 D-HeadPart, i.e. GGT 5' overhang. false George Zarubin component2121643 1 BBa_K576001 component2121640 1 BBa_B0034 component2121638 1 BBa_J23101 annotation2121638 1 BBa_J23101 range2121638 1 1 35 annotation2121640 1 BBa_B0034 range2121640 1 44 55 annotation2121643 1 BBa_K576001 range2121643 1 62 545 BBa_K576005_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaggttgaagagatc BBa_B0034_sequence 1 aaagaggagaaa BBa_K576001_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaggttgaagagatc BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z