BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K576012 1 BBa_K576012 J23101-RBS-GFP1-Lox-GFP2-Transcription Terminator 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z Negative control In this negative control, GFP1 and GFP2, followed by a transcriptional terminator, flank RFC10 resulting in a stop-codon-containing scar. No fluorescence is expected for this component (background) because translation is interrupted. false false _747_ 0 10155 9 Not in stock false Negative control false Joon Hyuk Hong component2121912 1 BBa_K576006 component2121900 1 BBa_K576005 component2121901 1 BBa_J61046 annotation2121901 1 BBa_J61046 range2121901 1 554 587 annotation2121912 1 BBa_K576006 range2121912 1 596 994 annotation2121900 1 BBa_K576005 range2121900 1 1 545 BBa_K576006 1 BBa_K576006 GFP2-Transcription Terminator 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z GFP2 by Davidson-Missouri 2007 Released HQ 2013 The RFC 53 TailPart with transcription terminator. false false _747_ 0 10155 9 In stock false The format is RFC53 D-TailPart, i.e. ATG 5' overhang. false Joon Hyuk Hong component2121653 1 BBa_B0015 component2121646 1 BBa_K576002 annotation2121653 1 BBa_B0015 range2121653 1 271 399 annotation2121646 1 BBa_K576002 range2121646 1 1 262 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K576002 1 BBa_K576002 GFP2 TailPart 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z BBa_I715020 Copy of <partinfo>BBa_I715020</partinfo> in the RFC53 Tail Format. false false _747_ 0 7330 9 Not in stock false The reading frame fix in the front is unnecessary. The part is in recommended RFC53 D-Tail format, i.e. the overhang is 5' ATG. false George Zarubin annotation2121630 1 MetaPrefix range2121630 1 1 10 annotation2121631 1 GFP2 range2121631 1 11 262 BBa_K576005 1 BBa_K576005 J23101-RBS-GFP1 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z GFP1 by Davidson-Missouri 2007 Released HQ 2013 The RFC53 HeadPart with promoter and RBS attached. false false _747_ 0 7330 9 In stock false The format is RFC53 D-HeadPart, i.e. GGT 5' overhang. false George Zarubin component2121643 1 BBa_K576001 component2121638 1 BBa_J23101 component2121640 1 BBa_B0034 annotation2121638 1 BBa_J23101 range2121638 1 1 35 annotation2121640 1 BBa_B0034 range2121640 1 44 55 annotation2121643 1 BBa_K576001 range2121643 1 62 545 BBa_J61046 1 lox [Lox] site for recombination 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob Released HQ 2013 bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_K576001 1 BBa_K576001 GFP1 HeadPart 2011-06-19T11:00:00Z 2015-05-08T01:12:45Z BBa_I715019 Copy of <partinfo>BBa_I715019</partinfo> in the RFC53 Head Format. false false _747_ 0 7330 9 Not in stock false The part is in recommended RFC53 D-Head format, i.e. the overhang is 5' GGT. false George Zarubin annotation2121628 1 GFP1 range2121628 1 1 474 annotation2121629 1 MetaSuffix range2121629 1 475 484 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K576006_sequence 1 gagctcttcaatgaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K576005_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaggttgaagagatc BBa_B0034_sequence 1 aaagaggagaaa BBa_K576012_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaggttgaagagatctactagagataacttcgtataatgtatgctatacgaagttattactagaggagctcttcaatgaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J61046_sequence 1 ataacttcgtataatgtatgctatacgaagttat BBa_K576001_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaggttgaagagatc BBa_K576002_sequence 1 gagctcttcaatgaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z