BBa_K156026 1 BBa_K156026 Strong RBS + SBFP2 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This is a composite part. This composite part is made of a strong, standard ribosomal binding site and a part that codes for blue fluorescent protein, which can be used as a reporter. false false _246_ 0 1475 9 It's complicated true No special design considerations. false George McArthur IV component1993854 1 BBa_B0034 component1993855 1 BBa_K156010 annotation1993854 1 BBa_B0034 range1993854 1 1 12 annotation1993855 1 BBa_K156010 range1993855 1 19 738 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K156010 1 SBFP2 SBFP2 (strongly enhanced blue fluorescent protein) 2008-10-28T12:00:00Z 2016-01-26T09:51:52Z OFP was cloned from the tentacles of ''Cerianthus'' sp., a tube anemone. The original sequence was obtained from GenBank (VERSION AY296063.1, GI:31616578). This part codes for orange fluorescent protein (OFP). Fluorescent proteins are useful tools for visualizing and quantifying protein expression in cells. OFP is yet another fluorescent protein, like GFP, that can be utilized as a reporter. false false _246_ 4206 1475 9 It's complicated true This part was codon-optimized for expression in ''E. coli''. The following restriction enzyme sites were also removed: EcoRI, NotI, XbaI, SpeI, PstI, NheI, AvrII, ApoI, MfeI, NsiI, SbfI. false George McArthur IV BBa_K577899 1 BBa_K577899 pTet promoted BFP 2011-09-14T11:00:00Z 2015-05-08T01:12:46Z Spring 2011 iGEM Kit Plates A reporter plasmid using pTet as a constitutive promoter in front of a BFP gene. Within 24 hours, cells should fluoresce blue. This part can be paired with the TetR gene to repress the pTet promoter. false false _748_ 0 8430 9 It's complicated false The composite part K156026 which included B0034+K156010 was used as combined as a suffix insertion into the pTet backbone. false Kyle Jones component2128855 1 BBa_R0040 component2128863 1 BBa_K156026 annotation2128863 1 BBa_K156026 range2128863 1 63 800 annotation2128855 1 BBa_R0040 range2128855 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K156026_sequence 1 aaagaggagaaatactagatggttagcaaaggtgaagagctgtttactggtgttgttccgatcctggttgaactggacggtgatgttaacggccacaagttctccgtgtctggcgaaggcgagggcgatgctacctacggtaaactgaccctgaagttcatctgtaccactggtaaactgccggtaccgtggccgaccctggttaccaccctgagccatggtgttcagtgttttgcacgttacccggatcacatgaagcagcatgatttcttcaagtctgcgatgccggagggttacgtccaggaacgcactatcttcttcaaagacgacggcaactataaaacccgtgccgaggttaagtttgagggtgacaccctggtcaaccgtattgaactgaaaggtatcgacttcaaagaagacggcaacattctgggtcacaaactggagtacaacttcaacagccataacgtgtacatcaccgccgataaacagaagaacggcatcaaagctaacttcaagattcgtcacaacatcgaagatggtggtgttcaactggctgatcactaccagcagaacacgccgatcggtgatggcccggtactgctgcctgacaaccattatctgtctacccagtctaaactgagcaaagacccgaatgagaaacgtgatcacatggtgctgctggagttcgtgactgcggcaggtatcacgctgggtatggacgaactgtataaatga BBa_K577899_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggttagcaaaggtgaagagctgtttactggtgttgttccgatcctggttgaactggacggtgatgttaacggccacaagttctccgtgtctggcgaaggcgagggcgatgctacctacggtaaactgaccctgaagttcatctgtaccactggtaaactgccggtaccgtggccgaccctggttaccaccctgagccatggtgttcagtgttttgcacgttacccggatcacatgaagcagcatgatttcttcaagtctgcgatgccggagggttacgtccaggaacgcactatcttcttcaaagacgacggcaactataaaacccgtgccgaggttaagtttgagggtgacaccctggtcaaccgtattgaactgaaaggtatcgacttcaaagaagacggcaacattctgggtcacaaactggagtacaacttcaacagccataacgtgtacatcaccgccgataaacagaagaacggcatcaaagctaacttcaagattcgtcacaacatcgaagatggtggtgttcaactggctgatcactaccagcagaacacgccgatcggtgatggcccggtactgctgcctgacaaccattatctgtctacccagtctaaactgagcaaagacccgaatgagaaacgtgatcacatggtgctgctggagttcgtgactgcggcaggtatcacgctgggtatggacgaactgtataaatga BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K156010_sequence 1 atggttagcaaaggtgaagagctgtttactggtgttgttccgatcctggttgaactggacggtgatgttaacggccacaagttctccgtgtctggcgaaggcgagggcgatgctacctacggtaaactgaccctgaagttcatctgtaccactggtaaactgccggtaccgtggccgaccctggttaccaccctgagccatggtgttcagtgttttgcacgttacccggatcacatgaagcagcatgatttcttcaagtctgcgatgccggagggttacgtccaggaacgcactatcttcttcaaagacgacggcaactataaaacccgtgccgaggttaagtttgagggtgacaccctggtcaaccgtattgaactgaaaggtatcgacttcaaagaagacggcaacattctgggtcacaaactggagtacaacttcaacagccataacgtgtacatcaccgccgataaacagaagaacggcatcaaagctaacttcaagattcgtcacaacatcgaagatggtggtgttcaactggctgatcactaccagcagaacacgccgatcggtgatggcccggtactgctgcctgacaaccattatctgtctacccagtctaaactgagcaaagacccgaatgagaaacgtgatcacatggtgctgctggagttcgtgactgcggcaggtatcacgctgggtatggacgaactgtataaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z