BBa_K578001 1 BBa_K578001 E. coli CRISPR I leader sequence 2011-09-26T11:00:00Z 2015-05-08T01:12:46Z Synthesized by IDT. Sequence derived from Escherichia coli str. K-12 substr. MG1655, complete genome (U00096.2) 2876486 to 2876591. This is the AT-rich leader region of the CRISPR I array in Escherichia coli str. K-12 substr. MG1655. "Identification and characterization of E. coli CRISPR-cas promoters and their silencing by H-NS" (??. Pul ''et al'', 2010) characterized a single promoter (Pcrispr1) in this sequence. Transcription is silenced through H-NS binding to the leader sequence. Induction requires anti-silencing, either by protein-independent processes, DNA-binding proteins or other modulatory mechanisms not yet identified. false false _749_ 0 9217 9 It's complicated false Determination of the specific region was made according to ??. Pul ''et al''. false iGEM11_Arizona_State annotation2149421 1 Leader range2149421 1 1 106 BBa_K578001_sequence 1 tctaaaagtatacatttgttcttaaagcattttttcccataaaaacaacccaccaaccttaatgtaacatttccttattattaaagatcagctaattctttgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z