BBa_K578002 1 BBa_K578002 T7LRSR (Listeria innocua CLIP11262) 2011-09-26T11:00:00Z 2015-05-08T01:12:46Z This part is based off of the genomic sequence for Listeria Innocua CLIP11262 and was synthesized by Integrate DNA Technologies This brick, T7LRSR, is the starting point for a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) array based around Listeria Innocua CLIP11262. The sequence of the part is composed of a T7 promoter, Lac Operator, Leader Sequence (from Listeria Innocua CLIP11262), Palindromic Repeat, Spacer (Targeted to sequence with correct protospacer and 'NGG; Protospacer-adjacent motif), followed by a palindromic repeat. After the aforementioned sequences there is a pseudospacer with the standard BioBrick suffix (with SpeI and PstI Sites). The suffix allows for parts (eg.Repeat.Spacer Repeat, RSR, formated BioBricks) to be added onto the distal end of the CRISPR array. false false _749_ 0 9219 9 It's complicated false This part is intended to be the starting point of a constructible CRISPR array, thus no scars can be introduced in between the Leader Sequence and and initial repeat. Also when constructing an array close to a 100% sequence similarity between the spacer and protospacer is required for CRISPR effector function. false Kylie Standage-Beier annotation2145129 1 Leader Sequence range2145129 1 43 170 annotation2145135 1 Spacer (anti-GFP) range2145135 1 207 239 annotation2145130 1 Repeat range2145130 1 171 206 annotation2145128 1 T7 Promoter/LacO range2145128 1 1 42 annotation2145136 1 Repeat range2145136 1 240 275 BBa_K578002_sequence 1 taatacgactcactataggggaattgtgagcggataacaattgagttcaaatgatctttgaaaactaaatagattttatgtgaaccataaaataagcattcaaaattgaaatcttgctatggatgaatggcgcgattacgaaatctaggagaataaaaaattctacgagggttttagagctatgttattttgaatgctaacaaaacgaaacattcttggacacaaattggaatacaactgttttagagctatgttattttgaatgctaacaaaacaacagtataaaagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z