BBa_K578004 1 BBa_K578004 Bacillus halodurans C-125 CRISPR leader sequence 2011-09-27T11:00:00Z 2015-05-08T01:12:46Z Synthesized by IDT. Genome coordinates 355127-355361. This is a putative leader sequence for the CRISPR III locus in Bacillus halodurans C-125. false false _749_ 0 9217 9 It's complicated false This part has not been characterized in the literature. The sequence comprises the intergenic region between the CRISPR III locus and the Cas gene locus, which is AT rich as expected. The leader sequence for E. coli CRISPR I has been characterized and was used as a basis for this part. false Ethan Ward annotation2149424 1 misc range2149424 1 1 235 BBa_K578004_sequence 1 attgagaaaaatttaaaaatacatctaaaaaccttcgatgatataaaactatgaatttgtaaatggtgcggaccccaagcgcacataaaatccctgggaggtgcgcacctgttgatgcgactggatttctgataaaatacatagcgaaaaatgccaaattgtagtaatctaaaaacaggttcgcacttttgcccagttggaagccttgtctcgcaagccttccaactgggcgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z