BBa_K581022 1 BBa_K581022 A-factor regulated promoter 2011-09-27T11:00:00Z 2015-05-08T01:12:46Z Synthesized. This the Streptomyces autoinducer A-factor regulated promoter built from the ground up. false false _752_ 0 8589 9 Not in stock false Insertion of the A-factor receptor protein(ArpA) binding sequence in a constitutive promoter. false SUN Rui annotation2154939 1 arpA-binding promoter range2154939 1 1 30 BBa_K581022_sequence 1 ttgacataccgaccggtcggtatgtataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z