BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K584003 1 BBa_K584003 Lambda cI and LuxR regulated - hybrid promoter + GFP generator 2011-08-15T11:00:00Z 2015-05-08T01:12:47Z / Released HQ 2013 This part was designed to test the functionality of the promotor region. false false _755_ 0 9879 9 In stock true / false Bakul Jitendra Vinchhi, Sarah Veugelen, Katrien Vandermeeren, Yana Hoorne component2125178 1 BBa_E0240 component2125160 1 BBa_R0065 annotation2125178 1 BBa_E0240 range2125178 1 106 981 annotation2125160 1 BBa_R0065 range2125160 1 1 97 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0065 1 cI+luxR Promoter (lambda cI and luxR regulated -- hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 cI repressor negatively regulates this promoter and LuxR activates its transcription.The effect of cI is dominant over LuxR. This part is based on the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron Weiss. It requires the binding of two cI repressor dimers for maximal repression and contains two cI repressor binding sites namely, OR1 and OR2. This promoter is leaky in the sense that 'some' transcription is seen in the absence of both cI and LuxR. </P> <P>&nbsp;</P> <table width="75%" border="1"> <tr> <td><strong>LuxI</strong></td> <td><strong>cI</strong></td> <td><strong>activity of promoter</strong></td> </tr> <tr> <td>+</td> <td>+</td> <td>zero</td> </tr> <tr> <td>+</td> <td>-</td> <td>maximum</td> </tr> <tr> <td>-</td> <td>+</td> <td>zero</td> </tr> <tr> <td>-</td> <td>-</td> <td>leaky (no quantitative information)</td> </tr> </table> <P>&nbsp;</P> false false _1_ 0 24 7 In stock false <P> <P>This part was designed based on the LuxR and cI repressor regulated hybrid promoter tested by Ron Weiss and the LuxR-LuxICDABE sequence annotated by Tom Knight <genbank>AF170104</genbank>. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1986774 1 BBa_R0065 range1986774 1 1 97 annotation1986780 1 OR1 cI range1986780 1 81 97 annotation1986775 1 Lux Box range1986775 1 6 25 annotation1986777 1 OR2 cI range1986777 1 57 73 annotation1986779 1 -35 range1986779 1 71 76 annotation1986781 1 -10 range1986781 1 94 97 annotation1986778 1 lux p(R) start range1986778 1 58 58 annotation1986776 1 -10 range1986776 1 47 52 BBa_E0240 1 GFP report GFP generator 2004-10-17T11:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 B0032.E0040.B0015 false true _11_1_ 0 61 7 In stock false true Jennifer Braff component1249213 1 BBa_B0032 component1249216 1 BBa_E0040 component1249231 1 BBa_B0012 component1249221 1 BBa_B0010 annotation1249231 1 BBa_B0012 range1249231 1 836 876 annotation1249221 1 BBa_B0010 range1249221 1 748 827 annotation1249213 1 BBa_B0032 range1249213 1 1 13 annotation1249216 1 BBa_E0040 range1249216 1 20 739 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0032_sequence 1 tcacacaggaaag BBa_E0240_sequence 1 tcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K584003_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0065_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z