BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_J45503 1 hybB hybB Cold Shock Promoter 2006-06-20T11:00:00Z 2015-08-31T04:08:49Z Chris Voigt Lab at UCSF This cold shock promoter is only active at temperatures lower than 30 degree Celsius. false false _84_ 0 642 84 Not in stock false None. false Stephen Payne BBa_K584014 1 BBa_K584014 HybB promoter + Ribokey 2011-08-15T11:00:00Z 2015-05-08T01:12:47Z / More information will be added soon. false false _755_ 0 9879 9 It's complicated true / false Bakul Jitendra Vinchhi, Sarah Veugelen, Katrien Vandermeeren, Yana Hoorne component2132296 1 BBa_J45503 component2132297 1 BBa_J23008 annotation2132297 1 BBa_J23008 range2132297 1 402 495 annotation2132296 1 BBa_J45503 range2132296 1 1 393 BBa_K584014_sequence 1 cgccgctatggactggataaagagatggtaatggatttctttcgtgagaataattcctgttctacgttgcgcttttttatggccggttatcgcctcgaaaattgatcaaacatacgtattatcttgctttaattaattacactaatgcttcttcccttcgttttagcgccccgccgcagtatcatgatatcgataaccataataaatgtgtggtaaatggcgcatcgatcgcattattgattttgcgattgaggcaaaatatatgccaggtcttcgcaacggaataactataaatgactggagataacaccctcatccattctcacggcattaaccgtcgtgatttcatgaagctttgtgcagcattagccgccaccatggggttaagtagcatactagagacccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J45503_sequence 1 cgccgctatggactggataaagagatggtaatggatttctttcgtgagaataattcctgttctacgttgcgcttttttatggccggttatcgcctcgaaaattgatcaaacatacgtattatcttgctttaattaattacactaatgcttcttcccttcgttttagcgccccgccgcagtatcatgatatcgataaccataataaatgtgtggtaaatggcgcatcgatcgcattattgattttgcgattgaggcaaaatatatgccaggtcttcgcaacggaataactataaatgactggagataacaccctcatccattctcacggcattaaccgtcgtgatttcatgaagctttgtgcagcattagccgccaccatggggttaagtagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z