BBa_K584026 1 BBa_K584026 Constitutive_Promoter + AFP(Antifreeze extra-cellular Protein Generator) 2011-09-18T11:00:00Z 2015-05-08T01:12:47Z This part contains the constitutive promoter (J23119) and the Antifreeze Protein (AFP) sequence behind it. false false _755_ 0 9860 9 Not in stock false false Bakul Jitendra Vinchhi, Sarah Veugelen, Katrien Vandermeeren, Yana Hoorne component2222907 1 BBa_J23119 component2222922 1 BBa_K584020 annotation2222922 1 BBa_K584020 range2222922 1 44 914 annotation2222907 1 BBa_J23119 range2222907 1 1 35 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K584020 1 BBa_K584020 AFP extracellular protein generator 2011-09-16T11:00:00Z 2015-05-08T01:12:47Z This part contains BBa_K584019 [ OmpA_transmembrane_domain + Linker + point_mutant_HPLC6(AFP) ] with the B0034 RBS, B0015 Terminator and iGEM standard restriction sites EcoRI, NotI, XbaI and SpeI, NotI, PstI. false false _755_ 0 9860 9 It's complicated true false Bakul Jitendra Vinchhi, Sarah Veugelen, Katrien Vandermeeren, Yana Hoorne component2220791 1 BBa_K584019 component2220798 1 BBa_B0015 component2220786 1 BBa_B0034 annotation2220798 1 BBa_B0015 range2220798 1 743 871 annotation2220791 1 BBa_K584019 range2220791 1 19 734 annotation2220786 1 BBa_B0034 range2220786 1 1 12 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K584019 1 BBa_K584019 OmpA_transmembrane_domain + Linker + point_mutant_HPLC6(AFP) 2011-09-15T11:00:00Z 2015-05-08T01:12:47Z SOURCE - Pseudopleuronectes americanus (winter flounder) Gene - HPLC6 This composite part contains the two sequences OmpA and Point Mutant HPLC6(Antifreeze Protein - AFP) that are linked via a flexible linker. AFP normally is expressed intracellularly to prevent freezing of the cytoplasm, but in our system, it was essential that AFP was extracellularly anchored at the cell membrane, thereby preventing ice formation outside the cell. Therefore, we merged the AFP gene to OmpA via a flexible linker, thereby ensuring the desired extracellular localization of AFP. false false _755_ 0 9860 9 Not in stock false A point mutation at Base Pair number 156 of the HPLC6 sequence was performed by replacing the T in the wild-type coding sequence to C.This mutation was necessary as the sequence CTGCAG in the Wild-type coding sequence corresponded to a Pst1 restriction site. GCT(Wild type) and GCC(1 point mutant) are both valid triplet codons for Alanine. false Bakul Jitendra Vinchhi, Sarah Veugelen, Katrien Vandermeeren, Yana Hoorne annotation2129686 1 HPLC6_Point_Mutant range2129686 1 615 615 annotation2129681 1 OmpA range2129681 1 1 434 annotation2129683 1 Flexible_Linker range2129683 1 435 459 annotation2129685 1 HPLC6(AFP) range2129685 1 460 708 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K584020_sequence 1 aaagaggagaaatactagatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagcatggctctctcacttttcactgtcggacaattgattttcttattttggacaatgagaatcactgaagccagccccgaccccgcagccaaagccgccccagcagcagttgccgcccctgccgcagccgccccagacaccgcctctgacgccgccgccgcagccgcccttaccgccgccaacgccaaagccgctgccgaactcactgccgccaacgccgccgccgccgcagcagccaccgccagaggttaatactagagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K584019_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagcatggctctctcacttttcactgtcggacaattgattttcttattttggacaatgagaatcactgaagccagccccgaccccgcagccaaagccgccccagcagcagttgccgcccctgccgcagccgccccagacaccgcctctgacgccgccgccgcagccgcccttaccgccgccaacgccaaagccgctgccgaactcactgccgccaacgccgccgccgccgcagcagccaccgccagaggttaatactagag BBa_K584026_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagcatggctctctcacttttcactgtcggacaattgattttcttattttggacaatgagaatcactgaagccagccccgaccccgcagccaaagccgccccagcagcagttgccgcccctgccgcagccgccccagacaccgcctctgacgccgccgccgcagccgcccttaccgccgccaacgccaaagccgctgccgaactcactgccgccaacgccgccgccgccgcagcagccaccgccagaggttaatactagagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z