BBa_K587002 1 BBa_K587002 Crxst -> Lock sequence for concentration mechanism 2011-09-27T11:00:00Z 2015-05-08T01:12:47Z This part was based in the publication "Engineered riboregulators enable post-transcriptional control of gene expression" of Isaacs and his team in 2004. Also part of the idea comes from the team of UBC of 2009 that adapted the mechanism of Isaacs and put it in biobrick form. This part is based in the work of Isaacs and its team for the lock and key mechanism and in the work of the team of British Columbia University of 2009. This DNA sequence acts as a lock for the low arabinose concentration regulation path. In the construct the Pbad strong can activate the expression of the reporter protein GFP, but there is a previous step where there is the first lock (crxst); This first lock inhibits the expression of the reporter protein by joining the RBS and stopping the action of the mRNA polymerase to produce the mRNA and hence the protein. true false _758_ 0 8396 9 Discontinued false The sequence varies from the original biobrick of UBC in that this one is smaller. The loop was taken from the publication and the anti-sense design also was taken from the article. false David Ignacio Maycotte Cervantes BBa_K587002_sequence 1 aagcgcagtaattcacctcttggatttgggtatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z