BBa_K587003 1 BBa_K587003 Tast -> Key to unlock crxst 2011-09-27T11:00:00Z 2015-05-08T01:12:47Z Just as well as the Crxst (BBa_K587002), tast is developed from the idea of Isaacs team and BCU procedures This sequence acts as the key for the Crxst lock in the low concentration construct. It unlocks the Crxst, in order to activate following mechanism. The key must be at the same concentration than the lock, with the same promoter there is the activation of the key (tast) This key has an interaction with the sequence of the lock, inhibiting its action so the gene can be expressed, this event occurs when the key (tast) has a chemical interaction with the lock (crxst)blocking its action and letting the translation of the reporter protein true false _758_ 0 8396 9 Discontinued false Tast must be complementary to the Crxst, any mutation could make less effective or ineffective this part against the Crxst. false David Ignacio Maycotte Cervantes BBa_K587003_sequence 1 agatctctatataccataccaccaattaaaaagtaattggtggtttcgcgtcattaagtggagaacctaaagggatagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z