BBa_K587004 1 BBa_K587004 Tawk -> Key to unlock crxwk 2011-09-27T11:00:00Z 2015-05-08T01:12:47Z Isaacs' "Engineered riboregulators enable post-transcripcional control of gene expresion" article and the 2009 UBC igem project. This sequence acts as the key fot Crxwk lock and it unlocks it, in order to activate the following mechanism. It's design is based on the Isaacs' "Engineered riboregulators enable post-transcripcional control of gene expresion" article and the 2009 UBC igem project. true false _758_ 0 8396 9 Discontinued false It specificaly interacts with the Crwk lock part. Used on E. coli BW and DH5-alpha strains. false David Ignacio Maycotte Cervantes BBa_K587004_sequence 1 agatctctatataccataccaccaattaaaaagtaattggtggtttcgcgtcattaagtggagataaaccgtaagggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z