BBa_K587005 1 BBa_K587005 iTast -> inhibits the action of tast 2011-09-27T11:00:00Z 2015-05-08T01:12:47Z iTast is developed from the idea of Isaacs team and BCU team of 2009 procedures This is a complementary sequence for the Tast key, so we call it the antikey since it will inactivate the Tast key and preventing it to interact with the Crxst lock, so the lock would function and the repression of the reporter protein will occur. true false _758_ 0 8396 9 Discontinued false iTast must be complementary to the Tast, any mutation could make less effective or ineffective this part against the Tast. false David Ignacio Maycotte Cervantes BBa_K587005_sequence 1 tctaggagagatatatggtatggtggttaattttcattaaccaccaaagcgcagtaattcacctcttggtttccctatcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z