BBa_K587008 1 BBa_K587008 Crxst -> Lock sequence for low concentration mechanism 2011-10-08T11:00:00Z 2015-05-08T01:12:47Z Isaacs, FJ, Dwyer, DJ, Ding, C, Pervouchine, DD, Cantor, CR, and Collins, JJ. Engineered riboregulators enable post-transcriptional control of gene expression. 2004. Nature Biotechnology 22(7):841-847. This sequence forms part of the group of pieces directed to the expression of concentration mechanism developed by our team ITESM_MEXICO 2011. This part is based in the work of Isaacs and its team for the lock and key mechanism and in the work of the team of British Columbia University of 2009. This DNA sequence acts as a lock for the low arabinose concentration regulation path. In the construct the Pbad strong can activate the expression of the reporter protein GFP, but there is a previous step where there is the first lock (crxst); This first lock inhibits the expression of the reporter protein by joining the RBS and stopping the action of the mRNA polymerase to produce the mRNA and hence the protein. Crxst its resulting transcripst (crstRNA) blocks the recognition of the RBS by the ribosomal subunit (30s) by a cis system. this interaction prevents the translation of the repressor protein (GFP) A promoter can give the expression of the reporter gene. After transcription the mRNA shows a Ribosome Binding Site (RBS). The crstRNA is complementary to the RBS and is inserted downstream of the promoter. And upstream the RBS. After transcription a stem-loop is formed at the 5' end of the mRNA, this mRNA blocks the ribosome binding and the translation by cis repression. false false _758_ 0 8396 9 It's complicated false The sequence varies from the original biobrick of UBC in that this one is smaller. The loop was taken from the publication and the anti-sense design also was taken from the article. false David Ignacio Maycotte Cervantes BBa_K587008_sequence 1 aagcgcagtaattcacctcttggatttgggtatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z