BBa_K587010 1 BBa_K587010 Tast -> Key sequence for low concentration mechanism 2011-10-08T11:00:00Z 2015-05-08T01:12:47Z Isaacs, FJ, Dwyer, DJ, Ding, C, Pervouchine, DD, Cantor, CR, and Collins, JJ. Engineered riboregulators enable post-transcriptional control of gene expression. 2004. Nature Biotechnology 22(7):841-847. This sequence forms part of the group of pieces directed to the expression of a concentration mechanism developed by our team ITESM_MEXICO 2011. The activation of gene expression is achieved by transcribing a non coding RNA (taRNA) produced by a second promoter (the same promoter dependant on the concentration amount). This mRNA targets the crRNA (either crstRNA or crwkRNA) specifically. In this case this key targets the crstRNA. The tastRNA is designed to hybridize the stem-loop created by the crstRNA and unfolds the loop exposing the Ribosome Binding Site (RBS) and allowing translation. The interaction between tastRNA and crstRNA undergo a linear-loop interaction that exposes the RBS followed by the activation of the reporter protein (CFP). It has the same mechanism of action proposed by the team of British Columbia of 2009. Part: BBa_K206031 false false _758_ 0 8396 9 It's complicated false The sequence varies from the original biobrick of UBC in that this one is smaller. The loop was taken from the publication and the anti-sense design also was taken from the article of Isaacs. false David Ignacio Maycotte Cervantes BBa_K587010_sequence 1 agatctctatataccataccaccaattaaaaagtaattggtggtttcgcgtcattaagtggagaacctaaagggatagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z