BBa_K587012 1 BBa_K587012 iTast -> Antikey sequence for high concentration mechanism 2011-10-08T11:00:00Z 2015-05-08T01:12:47Z Isaacs, FJ, Dwyer, DJ, Ding, C, Pervouchine, DD, Cantor, CR, and Collins, JJ. Engineered riboregulators enable post-transcriptional control of gene expression. 2004. Nature Biotechnology 22(7):841-847. This sequence forms part of the group of pieces directed to the expression of a concentration mechanism developed by our team ITESM_MEXICO 2011. The inactivation of gene expression is achieved by transcribing a non-coding RNA (itastRNA) produced by a third promoter (following activation of pBADwk in the presence of arabinose). This mRNA targets the tastRNA specifically. The itastRNA is designed to lock again the complex crstRNA-RBS due to hybridization with tastRNA; inhibiting the expression of the reporter protein at low concentration. It allows only the expression of the high concentration mechanism. false false _758_ 0 8396 9 It's complicated false This is an original design with the objective of enhancing the mechanism designed by British Columbia in 2009. false David Ignacio Maycotte Cervantes BBa_K587012_sequence 1 tctaggagagatatatggtatggtggttaattttcattaaccaccaaagcgcagtaattcacctcttggtttccctatcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z