BBa_K588001 1 BBa_K588001 ptrp 2011-09-25T11:00:00Z 2015-05-08T01:12:47Z Synthesized by IDT Released HQ 2013 Tryptophan promoter and operator false false _759_ 0 9140 9 In stock false The sequence contains SpeI sites at positions critical for function. We modified the SpeI site in the biobrick suffix to an NheI site as done by UNAM 2010 false Kevin Lu annotation2142514 1 ptrpL range2142514 1 1 49 annotation2142550 1 ptrpO range2142550 1 20 40 BBa_K588001_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z