BBa_K590081 1 BBa_K590081 mamI 2011-09-21T11:00:00Z 2015-05-08T01:12:48Z From the AMB-1 genome. mamI is required for vesicle formation for later magnetosome growth in AMB-1. It localizes in a line in flourescence studies in AMB-1. false false _761_ 0 10497 9 Not in stock false none false Michael Brasino BBa_K590081_sequence 1 atgccaagcgtgattttcggactgctggcgcttgccctcggattgctgggggtgacggcatggtggtggtcggtgaccgagttcctgcgcggagcggtgccggtggccctgctcatccttggcttggtcgcgttggcctccggggtgcaatccgtgcggttgcctcgttccaacaaggggaccgcttcagaccctgacatcgatggttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z