BBa_K590085 1 BBa_K590085 pGA Suffix, reverse primer 2011-09-21T11:00:00Z 2015-05-08T01:12:48Z Synthetic Binds to the bglbrick suffix in gibson assembly vectors (pGA series). false false _761_ 0 10497 9 Not in stock false Does not contain Not1, which makes gibson cloning difficult. false Michael Brasino annotation2138472 1 pGAsuff_rev range2138472 1 1 21 BBa_K590085_sequence 1 ctcgagaaccctgttggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z